gudB [2019-04-05 10:33:23]

glutamate dehydrogenase, trigger enzyme

Locus: BSU22960

Isoelectric point: 5.58

Molecular weight: 47.05 kDa

Protein length: 427 aa

Gene length: 1284 bp

Function: glutamate utilization, control of GltC activity

Product: glutamate dehydrogenase, trigger enzyme

Essential: no

E.C.: 1.4.1.2

Synonyms: ypcA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of glutamine/ glutamate
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Information processing → Regulation of gene expression → Trigger enzyme → Trigger enzymes that control gene expression by protein-protein interaction with transcription factors
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 2,402,067 → 2,403,350

Phenotypes of a mutant

• The gene is cryptic. If gudB is activated (gudB1 mutation), the bacteria are able to utilize glutamate as the only carbon source. PubMed
• A rocG gudB mutant is sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin due to the downregulation of the SigW regulon PubMed
• transcription profile of a rocG gudB mutant strain: GEO PubMed

The protein

Catalyzed reaction/ biological activity

• L-glutamate + H₂O + NAD⁺ = 2-oxoglutarate + NH₃ + NADH + H⁺ (according to Swiss-Prot)

Protein family

• Glu/Leu/Phe/Val dehydrogenases family (according to Swiss-Prot)

Paralogous protein(s)

• RocG

Modification

• phosphorylated on Arg-56, Arg-83, and Arg-421 and/or Arg-423 PubMed

Cofactors

• NAD⁺/NADH + H⁺

Structure

• 3K8Z (enzymatically active GudB1) PubMed

Additional information

• GudB is subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

• Genes: gudB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutively expressed PubMed

Biological materials

Mutant

• MGNA-A397 (ypcA::erm), available at the NBRP B. subtilis, Japan
• GP691 (ΔgudB::cat), GP1160 (ΔgudB::aphA3) both available in Jörg Stülke's lab
• BKE22960 (ΔgudB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
• BKK22960 (ΔgudB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
• GP2834 (gudB⁺⁺), available in Jörg Stülke's lab

Expression vectors

• for purification of GudB from E. coli carrying an N-terminal Strep-tag: pGP863 (in pGP172) available in Jörg Stülke's lab
• for purification of GudB1 from E. coli carrying an N-terminal Strep-tag: pGP864 (in pGP172) available in Jörg Stülke's lab
• for ectopic expression of gudB with its native promoter: pGP900 (in pAC5), available in Jörg Stülke's lab
• wild type gudB, expression in B. subtilis, in pBQ200: pGP1712, available in Jörg Stülke's lab
• pBP179 (N-terminal Strep-tag gudB+, purification from B. subtilis, for SPINE, in pGP380), available in Fabian Commichau's lab

LacZ fusion

• pGP651 (in pAC5), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab

FLAG-tag construct

• GP1194 (gudB, spc, based on pGP1331), GP1195 (gudB1, spc, based on pGP1331), available in Jörg Stülke's lab

Antibody

• antibody against RocG recognizes GudB, available in Jörg Stülke's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Fabian Commichau, Göttingen, Germany homepage

References

Reviews

Loading

Original publications

Loading